Baggterien

Scheinbar mit links wird täglich Neues erschaffen, Vorhandenes vervielfältigt. In ein paar Zeilen bekommen Sie einen tiefen Einblick ins Tagesgeschäft der Natur.

Wenn Sie ein Haus bauen wollen, brauchen Sie einen Plan. Einen Bauplan. In diesem steht dann, wie tief das Loch für den Keller sein muss, wie viele Ziegel wo gestapelt werden müssen, wo ein Fenster hinkommt und so weiter. Alles, was getan werden muss, um ein Haus entstehen zu lassen, ist auf diesem Plan verzeichnet. Aller­dings steht nirgendwo, wer das alles machen soll. Wer die ganzen Ziegel schleppen soll. Wer die Türen und Fenster einbaut und wer die Zimmer ausmalt. Das ist irgendwie nicht verwunderlich, denn der Plan wurde ja von einem Menschen geschrieben. Ich sage das jetzt sehr ungern aber wir – das schließt mich mit ein – sind nicht perfekt. Man(n) gesteht sich das selten ein, aber die Natur (ein Weibsstück) kann das besser:
Die Natur baut selten ein Haus, darum möchte ich Ihr Können am Bauplan eines Baggteriums veranschaulichen. Der Plan heißt Genom und ist in einem ziemlichen Kauderwelsch geschrieben. Unser Hausplan ist von technischer Vollendung, auf einen Blick weiß man, was das einmal werden soll. Das Genom ist nicht schön anzusehen, als Mensch sieht man es eigentlich überhaupt nicht. Es ist eine Kette komplizierter chemischer Verbindungen (Nucleotide bzw. Basen) mit Seitenketten, Ringen und allerhand chemischen Schnickschnaks, was man vereinfacht auch als Buchstabenreihe darstellen kann. Ich mache einmal einen Anfang und lese so ins Genom eines Baggteriums hinein:
ATGTTGCGGGCATTCGTAATGCTCATATAGCAACGTCAATTTCACAGCAATTC GCAAGAGAGCCAACACAAATCGTATTGGGGCCCCTTCCGTCGATCAGGCTCAA CATATGGCCCCTTGCCGTCGATCAGGCTCAACATA... usw
A, T, G, C. Nur diese vier Buchstaben. Das wirkt jetzt etwas unhandlich, eine Zeichnung wäre ­vielen wohl lieber gewesen. Es ist jedoch klar, dass das ein Code sein muss, denn es finden sich keine Höhen oder Breitenangaben irgend­welcher Art. Nichts lässt auf eine Anleitung zum Bau eines Baggteriums schließen.
Zum Glück ist der Code nicht schwer zu entschlüsseln. Immer drei Buchstaben ergeben einen Ziegel. ATG heißt START. Mathematisch ergibt das bei vier Elementen blablabla viele Kombinationsmöglichkeiten, das würde jetzt blablabla viele Ziegel ergeben. Aber hey, das Leben ist gar nicht so kompliziert, es gibt nur 20 verschiedene Ziegel (Aminosäuren). Für ein und denselben Ziegel gibt es folglich mehr als einen Code, ­anders gesagt: Ein Ziegel kann unterschiedlich codiert sein. Jetzt wissen wir also, welche Ziegel wir für den Bau unseres Baggterium, benötigen, doch wie groß soll es werden? Welche Form soll es haben? Wo sind die Höhenangaben? Wie dick wird es? Was wird es können?
Viele Fragen. Die Natur löst sie mit vollendeter Eleganz. Wir lehnen uns zurück und dürfen heute einmal zuschauen. Die Ziegel bilden wieder Ketten, genau in der Reihenfolge, wie sie auf der DNA codiert sind. Es entstehen unterschiedlich lange Ketten, die sich verschieden winden und falten. In diesem Moment offenbart die Natur ihre Genialität. Ein Teil dieser Ketten (auch Proteine genannt) sind nämlich ziemliche Wiffzacks (man nennt sie hin und wieder auch Enzyme). Diese Kerlchen leisten ganze Arbeit. Sie bauen nicht nur das Baggterium auf, sondern regeln dann im Fertigbau auch noch alle Abläufe. Das ist so, als würden die Maurer und Installateure eines Restaurants nach der Fertigstellung noch als Koch und Kellner arbeiten. Da wird Zucker in Energie verbrannt, Sauerstoff veratmet und Sonne getankt. Die Enzyme sind die Hackler am Bau, während der Rest der Proteine verarbeitet wird. Proteine können als Türen verwendet werden oder als Baugerüst. Verbaut werden aber nicht nur Proteine, sondern zum Beispiel auch Lipide (Fette) oder Polysaccharide (Zucker­verbindungen). Die Größe des Baggteriums wird schließlich durch die Anzahl der codierten Proteine bestimmt und von den physikalischen Beschränkungen der Bauweise. In dem Punkt sind wir also doch der Natur überlegen, denn einen Wolkenkratzer bekommt man eben nur mit Stahlbeton zustande.

Neuen Kommentar schreiben

Plain text

  • Keine HTML-Tags erlaubt.
  • Internet- und E-Mail-Adressen werden automatisch umgewandelt.
  • HTML - Zeilenumbrüche und Absätze werden automatisch erzeugt.
By submitting this form, you accept the Mollom privacy policy.