#1, Jan 07

Ausgabe 1Der Bagger ist gelb, groß und hält sich am liebsten auf Baustellen auf. Mit seinen tonnenschweren Raupen überrollt er gnadenlos überflüssig gewordene Mauern und abrissbereite Konventionen. Er gräbt an allen Ecken und Enden – wo immer seine Fahrer und Fahrerinnen ihn gerade hinsteuern. Manchmal würde er sich am liebsten eingraben, ­schockiert darüber, was er da ausgräbt. Manchmal wird er auch rot vor Zorn! Oft nimmt er aber auch nur sich selbst auf die Schaufel ... und alles was im sonst noch so in die Quere kommt. Der Bagger baut ein Fundament – wofür, das weiß er selbst noch nicht so genau. Allen anderen ist er dennoch meistens eine Armlänge voraus.

Die Revolution

Lassen Sie Ihren Hund doch auf die Straße scheißen!

Gerne hätte ich an dieser Stelle einen sinn­vollen Beitrag in Form eines exzellenten Artikels zu einem revolutionären Thema geleistet. Ich hätte mich z.B. mit aller aufzubringenden Eloquenz und Sachlichkeit darüber ereifert, wie groß meine Abneigung gegen die in alle möglichen Bereiche dringende Forderung ist, sinnvolle Beiträge zu leisten. Am besten lässt sich diese Haltung aber möglicherweise mit einem Artikel vertreten, der versuchsweise von allen größeren Sinnzusammen­hängen befreit, aber dennoch in kritischem Ton gehalten ist. Der Lesbarkeit halber habe ich mich jedoch bemüht, mich weitestgehend an die allg. Grammatik und Rechtschreibung zu halten. D. Verf.

Nächtens plagt mich der grobe Unfug. Blutrote Fahnen schwingende Paarhufer fallen über die Sonne her, diese Metaphorik macht mich fertig. Keine Etymologin der Welt kann das er­klären! Soll sie nun Pflastersteine werfen auf die kieselgrauen Fassaden unserer zu düsteren Ruinen verkümmerten ach so säkularisierten Gedanken­gebäude, pfui, sage ich da, lieber ­nehme ich Blasen an den Füßen in Kauf als alle ungeschlachte Schafsköpfe, meiner Seel’! Anderer­seits, wenn man nun, was ja zum guten Ton gehört, alle Umstände einer genaueren Betrachtung unterzieht, was hat es dann überhaupt für einen Zweck, wenn man brav den Mantel an der Garderobe abgibt. Lassen Sie Ihren Hund doch auf die Straße scheißen! Keiner könnte sagen, naja, das war wieder einmal typisch und sowieso und gang und gäbe, diese ewige Litanei, herausgewürgt von mit Halbwissen eklektisch bestückten manikürten Klugscheißern mit Dachterrasse; so mancher Denkanstoß erstickt auf diese Weise, wie man sagt, im Keim. Es wäre hingegen durch­aus überlegenswert, die langsam dem Verfall anheim fallenden Kratzbäume unserer immer heterogeneren Gesellschaft (anderswo) aufzustellen, aber sozusagen tunlichst das Kinde nicht mit dem Bade auszuschütten, um die vermeintlich Wohlwollenden einzusperren in dunklen, wenn auch aufgrund struktureller Beschaffenheiten zur Aufbewahrung tiefgefrorener Moorleichen nur leidlich geeigneten Kellerschächten. Nun, Tausende und Abertausende leidende Seelen tragen nicht eben zur Lösung bei – mag auch alle Polemik gewissermaßen auf der Müllhalde landen; was getrost ad acta gelegt werden darf, wenngleich sich im Zuge der fortschreitenden Multiplikation der ständigen Da capo-Schreier auch gewaltig die Balken biegen. Rastlos wandert indes der große Weltenlenker – an verregneten Samstagabenden pflegt er auf seinem Menschenxylophon Tonarten zu erfinden –, indem er sich fortwährend ereifert, in seiner honiggelb getünchten Singlewohnung auf und ab, nicht ohne von Zeit zu Zeit gewitzt auf die eine oder andere Möglichkeit hinzu­weisen, etwa: Tragen Sie bei Tauwetter weder Kopftuch noch Kalotte, im schlimmsten Fall könn­ten Ihnen die Haare zu Berge stehen. Lautes Getöse, sage ich da, welches die ganze Tragweite dieser Umstände, denken Sie nur an die Folgen!, welches also die ganze Tragweite der genannten Umstände mit der unüberschaubaren Vielfalt all ihrer Parameter und Faktoren, die es da mit größter aufzubringender Sorgfalt zu eruieren und nach penibler Façon zu notieren gibt, den Fehler endlich zu Gehör bringt, zeit­lebens unbeachtet, nun doch posthum von Heuchlern der übelsten Sorte gewürdigt und mit allerlei Gold und Silber behängt, allerdings fehlt der Hinweis auf korrekte Vorgehensweise. Zahle aus diesem Grund niemals mit Kreditkarte; Fenster kriegt man auch ohne nennenswerte Inkommoditäten mit Zeitungspapier sauber. Alsbald regnen pomologische Mixturen auf myopische Frauen von gedrungenem Körperbau nieder, solcherart, dass man versucht ist zu denken, ein leibhaftiger Gottseibeiuns würde uns heimsuchen, während wir, nicht ahnend, dass wir damit nicht, wie fälschlicherweise angenommen etwas für die Rekonstitution allen irdischen Strebens und auch Sterbens tun, hundertmal aufgezeigt in diversen Hörfunksendungen und von einschlägigen Beratungsagenturen verwettet und verpulvert, weitersuchen nach dem kleinsten Karomuster, aber am falschen Ort. Den wenigsten ist das Insinuatiöse im Kern dieser nur scheinbar ­naiven Groteske bewusst, oder denken Sie, Arthur, nur an das weite Problem­feld der Kulturanthrosophomorphophilologie – Mattheson, dem der Geifer ja schier auf’s Obs­zönste aus dem zuvor mit allseits unbeliebten, farblose Konterfeis zur Schau stellenden Briefmarken voll gestopften Maul zu tropfen pflegt, spricht hier etwa vom sog. kontemplativistischen reraffinativen Affekt­affirmationsradius, nach dem Leitsatz hic Rhodus, hic salta!, während als gesichert an­genommen werden kann, weil a eben nicht gleich b ist, dass all diese gemeine Hedo­nistik in nicht allzu naher Zukunft die grüne ­Wiese austrocknen wird, auf der unsere und auch eure Kinder und Kindeskinder Gärten und abermals Gärten aus prächtigen Neurosen anlegen werden, sowie sie auch selbst dem grässlichsten Unkraut allen Lebenssaft entzieht, auf dass es nicht mehr sprieße, denn denken Sie nur, auch im Wasser befinden sich kleine narkomane Lebewesen (wie uns schon die unwürdigen Khitaristen im Flüsterton weismachen wollten), die Ihnen und den Ihren Böses wollen! Bleibt nur zu erwähnen, dass der Vollzug der von ganz ­unten angeordneten Maßnahmen zur Verhöhnung aller An- und Abwesenden im Eifer des Ge­fechts aus nicht näher zu benennenden Gründen, als da sind: 1.(a) Dialektische Hygrome sind in abs­tracto(!) mit aller gebotenen Vorsicht aufzustechen; dass der Vollzug dieser Maßnahmen also auf einem Parkplatz an der Hauptverkehrs­ader Westautobahn ausgesetzt wurde – zeitgleich übrigens mit der Auferstehung des totge­sagten (oder viel­mehr totgetretenen, wie manche munkeln) Katers Paul, ein buntschillerndes inkonvenables Pseudopetrefakt wie es im Buche steht, in der drückenden Schwüle einer bewölkten Vollmondnacht, ich weiß auch nicht, was das soll. Alles ist anonym geblieben, ignoramus et ignorabimus, sozusagen. Nun, und doch steht auch fest, dass man in gewissen Supermärkten erfahrungsgemäß besser einen jener Drahtverhaue auf Rädern verwendet, um die Anhäufung so genannter Nahrungsmittel, welche in selbigem Drahtverhau zu platzieren sind, zu erleichtern – ein alter Irrtum, zweifellos, aber egal. ­Niemand hat sich indes schändlicherweise bemüßigt gefühlt, der Zeit, der alten Schwätzerin, einmal ordentlich in den Arsch zu treten, wie soll das denn auch gehen, wenn sie jahrelang nur mit allerlei Koloratur­zeugs verzierte alte Scharteken abbürstet und Sterne zählt, nur nicht die Leoniden, diese pflegt sie, naturgemäß, sanft von schwarzsamtenem Nachthimmel zu pflücken und in einem dunkel­senffarbenen Necessaire, ein Gewirk aus 1.999 gedarrten dunkelsenffarbenen Engelszungen, zu verwahren, Tag ein, Tag aus, das ist ja unerträglich. Vielleicht einmal etwas Leichtes für zwischendurch? Völlig unhaltbar, würde der dienst­habende Idiot sagen – er war unterdes in fetteren Jahren der Mann von Welt – völlig unhaltbar, spräche er also und erginge sich – nicht ganz zu unrecht – in einer Betrachtung über die völlige Unhaltbarkeit ­dieser sowie überhaupt aller Thesen, ja, man könne sie geradezu als Ausgeburt einer, so Sie wollen, personifizierten, oder wie andere (z.B. Bavaria höchstselbst) es schlechthin auf den Punkt bringen würden, exempli­fizierten „Inkonsistenz“ betrachten, auch wenn das natürlich, milde ausgedrückt, totaler Bullshit ist.
Wie ja weiters namhaften Hobby-Eschatologen zufolge de facto schon seit Jahrzehnten, wenn nicht gar Jahrtausenden, nicht mehr von der Hand zu weisen ist, stößt Mutter Erde der ganze nachmoderne Kram, wie wir ihn von damals kennen, als Fahrräder noch keine Dynamos, Schulkinder noch keine Autos, Hausfrauen noch keine Rechte hatten, mitunter sauer auf, auch wenn heutzutage ja alles und jeder retro ist. Ertrin­ken könnte man ja in diesem Meer aus Lichtern, ­roten, gelben, xenonfarbenen, in dem auf und ab der urbane Tumult wogt, Schienenfahrzeuge wie Ameisen in einem Labyrinth auf einer frankobelgischen Hautelisse – Aufhören! Ich bitte Sie, das ist doch das Letzte, ein Eklat, wie ihn die Welt noch nicht gesehen hat! Schubert in der U-Bahn, was sagen Sie da, das geht doch gar nicht. Die ganze aufwendige Kollokation der letzten Jahre, die nebenbei noch dazu Unsummen verschlungen hat, die man stattdessen besser in An- oder Ausbau von Befreiungstheolog(i)en oder mensch­licher Ausbeutung investiert hätte, hat hier ­wieder einmal kläglich versagt, sei mir ein starker Fels, dass ich nicht lache. Nein, zum Weinen ist das alles, diese ganze verdammte Inversion des Guten und auch des Bösen, Brüder und Schwestern, diese ewige Lämmerschlachterei nebst abscheulichen Fratzen. Vermissen wir also den kostbaren Saft, der früher bevorzugt in rauhen Mengen in den pulsierenden Lebens­adern der Kontinente floss, nun aber in immer weiter fortschreitender Deamplifikation zu ­staubigen, mit Kadavern übersäten Landschaften verkrustet, wie sie etwa die kambrische eine ist, wenn man dort letztlich auch eher einen Lazzarone als einen Kadaver anträfe. Spucken Sie der Revolution ins Gesicht, c’est la guerre! Von mir aus hauen Sie auch dem Ursprung ­allen Übels eine runter! Das kann nicht schaden, die Welt as we know it ist höchstwahrscheinlich sowieso dem Untergang geweiht.

weiter...

Das Brechen der Ethno-Welle

Warum wir schrille Töne aus dem Orient lieben, den Musikantenstadl aber am liebsten warm abtragen würden.

Schon seit Jahren und mit nicht schwinden wollendem Interesse verfolgt und gefeiert, vollführt die so genannte „Ethno-Musik“ ihren nicht enden wollenden Siegeszug durch europäische Clubs und Veranstaltungslokale, Plattenläden und Kulturberichte. Dabei handelt es sich meistens um „modernisierte“ Volksmusik, die von Musikern unterschiedlichen Alters in unterschiedlichen Formationen und aus vielfältigen Ursprungsländern stammend vorgetragen wird. Publikum und Kritik brechen in standardisierte Begeisterung aus ob der kulturellen Vielfalt, die sich in den unterschiedlichen Musikstilen ausdrückt. Besonders beliebt und gefeiert sind dabei Multi-Kulti-Ethno-Bands, die sich aus zwei oder mehr Nationalitäten zusammensetzen und welche die unglaubliche Vielfalt zur Schau stellen, die entsteht, wenn sich aufgeschlossene Musiker unterschiedlicher Nationen mit verschiedenen Traditionen zu einer Symbiose zusammenschließen, die uns die musikalische und kulturelle Vielfalt als positive Aspekte der, ansonsten aus der Gutmenschen-Ecke viel kriti­sierten, Globalisierung näher bringet und zu unserem Wohlergehen und Ohrenschmaus sich als dienlich erweist. Doch nicht nur der Ohrenschmaus-Faktor, den kreischende asiatische Holzblasinstrumente, Viertelton-„Melodien“, arabeskes Gelalle und Buschtrommeln zeitigen – für unsere anspruchsvollen Ohren mit ­Reggae-Gitarren und brasilianischer Perkussion aufbereitet – sondern auch der Aspekt der Völker­verständigung, die meist optische und kulinarische Aufbereitung derartiger Veranstaltungen lassen uns eintauchen in eine uns, trotz scheinbarer medialer Omnipräsenz, immer noch „unbekannte“ fremdländische Kultur, die uns immer wieder in entzücktes Staunen zu versetzen in der Lage ist! („Das muss romantisch sein: in diesen Gewändern, nachts am Lagerfeuer, in der Wüste ... “
Woher aber diese Begeisterung? Liegt es an der Qualität der Musik, welche die Gratwanderung zwischen Tradition und Moderne in solch meisterlicher Weise bewältigt? Wenn der Musikantenstadl hochwertige und anspruchsvolle Musik hervorbringt, dann ja. Das Stadl-Konzept, Volksmusik mittels neueren Verfahren der Aufnahmetechnik zu Volkstümlicher Musik zu machen, findet unter der urbanen, „hippen“ Jugend keine Anhänger. Was aber unterscheidet die Machart jener Musik von der modernen „Weltmusik“? Bei genauer Betrachtung: nichts. Da wie dort werden in relativ billigen Verfahren Musikstile vermischt, wobei die eine Seite aus unerschöpflichem traditionellem Liedgut ent­steht, während die andere Seite aus den soeben am (Pop-)Musikmarkt gefragten Techniken hervorgeht. Definiert man nun anspruchsvolle und eigenständige Musik anhand ihrer Originalität, so werden weder der Stadl noch die Weltmusik dieses Prädikat verdienen.
Was zeichnet diese Veranstaltungen aber sonst aus, wenn nicht die soeben als wenig anspruchsvoll enttarnte Musik den Ausschlag gibt? Dazu sei angemerkt, dass hier nicht die Illusion verfolgt werden soll, dass Anspruch und Popula­rität Hand in Hand gehen, das Publikum der „Weltmusik“ wird aber nicht müde, sich immer wieder auf’s Neue als anspruchs- und niveauvolle Musikkonsumenten zu bezeichnen, daher muss der Frage, wo nun diese Qualität liegt, sehr wohl nachgegangen werden. In der Originalität der Musik offensichtlich nicht. Aber wir haben ja auf die Völkerverständigung, auf fremde Kulturen und Traditionen vergessen, auf die bunten Gewänder und die „lecker“-Spezialitäten aus Kirgisistan! Denn in diesen traditionellen ­Liedern und den bunten Begleiterscheinungen liegt so viel Weisheit und Lebensfreude, eine Offenheit, die wir kalten technisierten Europäer längst vergessen haben, ein Frohlocken ob der Wunder der Natur und, wie schon erwähnt, der Reiz des Fremden, des Geheimnisvollen und Ent­fernten. Das kann uns der Stadl nicht bieten? Bis auf den Reiz des Fernen – obwohl Belgrad bekanntlich Wien geographisch näher liegt als Bregenz – vereint diese Fernsehsendung alle genannten Punkte! Die Lebensfreude von schunkelnden Heurigenbänkensitzern, das weltoffene Grinsen der Akteure, die traditionellen Inhalte und die bunten Dirndln und Lederhosen lassen uns allerdings kalt und umgehend einen Sender suchen, auf dem gerade dunkelhäutige Lendenschurzträger Buschtrommeln malträtieren und dazu jodelartige Laute ausstoßen.
Denn der Musikantenstadl ist abgeschmackt, eine Deppenparade, uninteressant und wenig lehr­reich, ganz anders sind da ferne Klänge, etwas Neues, Ursprüngliches und Unverdorbenes, kurz, die Tradition, die in diesem Liedgut – für unsere Ohren aufbereitet – uns von Kulturen kündet, von deren Geschichte und Riten wir nur profitieren können. Die Texte? Natürlich können wir die nicht verstehen, schon bei der Sprache unserer östlichen Nachbarländer hört bei ­neunzig Prozent der Zuhörer die Verständnisfähigkeit auf. Wovon handelt aber Volksmusik? Gibt es eine Tradition, die weder nationalistisch noch religiös oder zumindest lokal-patriotisch ist? Komisch, solche Dinge sind doch normal „Pfui“! Was passiert bei diesem „Huga-Schaga“-Fest, von dem der Sänger spricht, und ist dieses Lied vielleicht die Meditation, die vor Ver­stümmelungsritualen gesungen wird? Viele Kulturen, von denen wir soviel lernen wollen, sind in einem anderen Kontext nicht durch bunte Gewänder und Lebensfreude aufgefallen, sondern durch weniger erfreuliche Eigenheiten: die Unterdrückung der Frau, die Blutrache, den bedingungslosen Gehorsam gegenüber der Familie oder der Religion, Ehrenmorde, Zwangsehen, Verarmung durch die Verpflichtung zur Mitgift und bewaffnete Konflikte, in denen ein seltsamer Begriff der ethnischen Zugehörigkeit und Tradition plötzlich zur Grundlage für Massenmorde und Kriegsverbrechen wird.
Wird also etwas überwunden, indem man bedingungslos alles, was von weit her kommt und fremdartig klingt, mit Entzücken und Wohlwollen aufnimmt? Die Hellhörigkeit und Weitsichtigkeit wird – ironischerweise – überwunden, die eigenen hart erkämpften „Traditionen“ wie Menschenrechte und Gleichberechtigung werden hier, geblendet von bunten Trachten, gering geschätzt („Dieses Lied wurde immer gesungen, wenn gefangen genommene Fremde in die Koch­töpfe geworfen wurden ...“).
Die Anziehungskraft der Ethno-Musik muss also vom ethischen Standpunkt her als äußerst fragwürdig eingestuft werden, aber so wie in vielen Traditionen den Menschen ein Ventil geschaffen wurde, versteckte Perversitäten auszuleben, so erfüllt eine solche Art von Veranstaltungen vielleicht gerade diesen Zweck für jene Leute, die, um „hip“ zu sein, selbstverständlich offen, aufgeschlossen, individualistisch und unabhängig sind.
Wie es bei Trends eben üblich ist, wird vom einzelnen nichts hinterfragt und alles akzep­tiert, was eben „in“ ist. Die soziologischen und politischen Hintergründe bleiben wieder einmal auf der Strecke, abgesehen von jenem Teil, der wiederum „in“ ist (Bist du gegen Globalisierung? Ja, du auch? Ok. Dann gehen wir gemeinsam in das kenianische Restaurant, das ist voll lecker!).
Allen Mutigen sei einmal der vergleichsweise harmlose Spaß eines sonntägigen Frühschoppens oder die faszinierende Exotik eines Schuhplattlers wärmstens empfohlen.

weiter...

Baustellen der Lyrik

„Dichtung muß von allen gemacht werden, nicht nur von einem.“ (Comte de Lautréamont)

„Der Lenz ist da, denn überall reißt man die Straßen auf“, sang 1985 Reinhard Mey in seinem Frühlingslied. Was er auf seiner ansehnlichen Liste von Jahreszeit-Merkmalen fehlen ließ (vielleicht als Betroffener?): Nicht nur Knospen und Asphaltschichten brechen im Frühjahr, auch die Gemüter der Amateurdichter – und Aber­dutzende Baggerschaufeln, nein, pardon, ­Federn (dergleichen Ergüsse geschehen selten am Computer) durchfurchen jungfräulichen Schreib­untergrund mit Straßen und Nebengäßchen.
Hier endet aber die Analogie bereits. Von ­allen Baustellen lieben wir bekanntlich die am meisten, die zumindest monate-, wenn nicht jahrelang Baustelle bleiben: Straßen, an denen veranschaulicht wird, daß sie mit einer oder ­einer halben von zwei Fahrspuren tadellos auskommen; Häuser, deren Stockwerkzahl ewig ungewiß bleibt; Rohrsysteme, die man ­lieber offen liegen läßt, um sich ihre sinnreichen Verzweigungen jederzeit neu in Erinnerung rufen zu können, und andere Prachtblüten des Städtebaus, wie sie jeder von uns vor dem Haus oder um die Ecke wuchern sieht. Jeder kann sie als Abenteuerspielplatz nutzen, den Arbeitern, wenn mal welche da sind, beim Arbeiten zu­sehen, ein Steinchen oder einen Zigarettenstummel in den Graben schnippen, er kann ein wenig Sand für sein Blumengärtchen mitnehmen, bei höheren Ansprüchen auch eine Rolle Kupferdraht oder eine neuwertige Mischmaschine. Regen wandelt die Geröllwüste zum Sumpf oder Steppensee im Wohnbezirk, Sturm verändert die Struktur der Baugerüste in höchst ästhetischer und lehr­reicher Weise, und so schafft die Natur ständig mit am offenen Kunstwerk.
Im Gegensatz dazu dichten die meisten Leute ex cathedra; ihr Gedicht entsteht in einem gänz­lich undemokratischen Prozeß unter Ausschluß der Öffentlichkeit, und dann stellen sie es vor die Welt zum Anstaunen hin wie den Eiffelturm oder den Moses des Michelangelo. Wer eine Zeile daran ändern wollte, würde als Vandale gebrandmarkt, wenn auch seine Änderung sich ausnähme wie ein vollendetes Graffito an einer urinfarbenen Bahnhofsmauer.
Muß das sein? Warum sollten selbstherrliche Verlagslektoren und Rechtschreib-Reformkommissionen die einzigen sein, die das Erscheinungsbild einer fertigen Dichtung verändern dürfen?

100 000 000 000 000 Sonette

Das dichterische Potential mathematischer Permutationen war schon den frühen Humanisten aufgegangen, nach ihnen den Barockdichtern, auch den deutschen: Philipp von Zesen, Johann Caspar Schade, allen voran Quirinus Kuhlmann im 41. seiner Himmlischen Libes-Küsse. Sie benutzten aber die „Proteus-Verse“ (benannt nach dem ewig die Gestalten wechselnden urgriechischen Meergott) nicht, um dem Leser die Chance zum Mitmachen zu geben, sondern nur, um die Inhalte ihrer Poeterei noch monumentaler hinzustellen – seien es nun Gedanken von philosophischer oder religiöser Tiefe oder nur das übermenschliche Ausmaß des eigenen Dichtertums. Zum Beispiel in dem Hexameter Rex, lex, lux, sal, sol, pax, fax, mons, fons, petra Christus („Fürst, Gesetz, Licht, Salz, Sonne, Friede, Leuchte, Berg, Quell, Fels ist Christus“) lassen sich zwar die ersten neun Worte 9!=362 880 mal umgruppieren, ohne das Versmaß zu beschädigen; der Sinn bleibt aber dabei auch haarscharf derselbe, und so hat der Leser von der Umstellerei nichts – es sei denn eine Meditation über die Unauslotbarkeit des Christusbegriffs.

Erst 1961 gab Raymond Queneau mit seinen Cent mille milliards de poèmes zum ersten Mal poetisches Material völlig in die Hand des Lesers. Wofür er mit seinem Namen geradestand, war nur ein schmales Bändchen mit zehn Sonetten (zu je 14 Versen, wie es sich gehört, und alle mit denselben Reimen: -ise, -eaux, -otte, -oques, -in); die aber waren mit großen Zeilenabständen auf starkes Papier gedruckt und dieses in Streifen von Versbreite geschnitten, so daß sich durch Blättern aus den 10 ersten, 10 zweiten ... 10 letzten Versen 99 999 999 999 990 weitere Kombinationen ergeben konnten.
Wenn man, so rechnet uns der Dichter vor, pro Minute ein neues Sonett erblättert und liest, 24 Stunden am Tag und 365 Tage im Jahr, so hat man gut 190 258 751 Jahre, während der man sich ununterbrochen im eigenen Klassikertum sonnen kann. Wer hat je solche Schaffenskraft an den Tag gelegt? Gut, man bedient sich dazu eines Bausatzes – aber nicht eines solchen, aus dem nur ein bestimmtes Flugzeugmodell entstehen kann, solange man nichts falsch macht, sondern eines klassischen Baukastens, wo jeder Stein auf jeden paßt: Heute wird es eine Ritterburg, morgen ein Bauernhof, übermorgen das Taj Mahal. Haben nicht die homerischen Epensänger mit ihren Formelversen genau dasselbe getan? Aber ihre Tradition ist versandet, Queneaus beginnt erst so richtig.

Volksdichtung, virtuell

Queneau starb 1976, vor Anbruch der Computer-Ära. Man kann ruhig voraussetzen, daß er das neue Spielzeug gerne benutzt hätte, um die Anzahl seiner Poeme in noch höhere Zehnerpotenzen explodieren zu lassen; vielleicht wäre er auch stolz gewesen, ein Büchlein verfaßt zu haben, kaum dicker als eine CD, aber mit einem Fassungsvermögen, das sich nicht in Megabytes, sondern nur in Tera-Sonetten angeben ließ. Die Verwalter seines Nachlasses, namentlich sein Sohn Jean-Marie Q., versuchen aber schon wieder, der Demokratisierung des Dichtertums via Internet einen Riegel vorzuschieben, und so sind Netzseiten wie ­http://x42.com/active/queneau.html, wo auf Mausklick ein Programm das Blättern erledigt und jedesmal ein neues Sonett zutage tritt (sogar mit Nachdichtung in Englisch und Schwedisch!), ständig durch Urheberrechts­klagen vom Aussterben bedroht. Andere, wie href="http://userpage.fu-berlin.de/~cantsin/permutations/queneau/poemes/poemes.cgi, „zitieren“ zum Selbstschutz nur ein paar ausgewählte Grund­sonette – auf der Berliner Seite sind es fünf, es ergeben sich also nur schlappe 100 000 Variationsmöglichkeiten. Das schadet aber nichts; zum vollen Genuß des Werkes empfiehlt es sich ohnehin, das zerschnipselte Buch zu kaufen und die Streifchen, möglichst auf Wanderschaft in der freien Natur, dem Frühlings- oder Herbstwind zu überantworten; kein Sterblicher dichtet besser.

Stützen der Welt

Die Hunderttausend Milliarden Gedichte (so heißt die deutsche Nachdichtung von Ludwig Harig) sind gewiß ein Baukasten für gehobene Ansprüche, aber eben doch nur ein Baukasten. Was wir suchen, ist aber eine wirkliche Bau­stelle der Poesie – das literarische Äquivalent nicht eines Fertigteilhauses, sondern etwa des Kölner Doms, der seit dem Baubeginn am 15. August 1248 bis 1880 ununterbrochen ganz offiziell als Baustelle galt, so daß der aus dem 16. Jahrhundert stammende Baukran nicht weniger zur Silhouette der Stadt Köln gehörte als die Türme. Nicht nur unzählbare Handwerker, sondern auch Dutzende namhafte Baumeister hinterließen ihre Spuren; Baupläne versanken im Sand der Jahrhunderte, wurden von Archäologen wieder hervorgescharrt und zu Zeiten umgesetzt, von denen ihre Zeichner nie geträumt hätten. Selbst heute ist und bleibt der Dom im Bau, denn die Bomben der Alliierten haben auf ihre Weise mitgebaut, und die Abgase des Kölner Straßenverkehrs, zusammen mit sonstigem Umweltschmutz, tun es noch. All das behindert aber weder die Meßfeiern der Gläubigen im Dom, noch scheint es die Ruhe der als Reliquien stets anwesenden Heiligen Drei Könige zu stören. Im Gegenteil, gerade die Unfertigkeit verleiht dem Bauwerk eine zusätzliche kosmologische Funktion, denn wie der Kölner Volksmund weiß, „wenn dä Dom ens fädich es, jeiht dr Welt unter“. Wo findet sich eine ähnlich amorphe Struktur in sprachlicher Form – fest, schwer entbehrlich, unübersehbar, aber doch sichtbar fluktuierend?

Rebell Leber

Blutvoll, lebenswichtig und angesichts der alt­hergebrachten Verschwisterung von Suff und Sangesfreude nicht einmal unerwartet, ist es gerade die Leber, die sich seit gut fünf­hundert Jahren den Erstarrungstendenzen der euro­päischen Poesie widersetzt. Die Leber ist das literarische Pendant des Kölner Doms – genauer gesagt, der Leberreim. Seine Grundfesten lassen sich bis ins 16. Jahrhundert zurückverfolgen; seine klassische Form zeichnete sich spätestens 1675 ab, in Georg Greflingers Complementir-Büchlein [...] mit angefügtem Trenchir-Büchlein und züchtigen Tisch- und Leberreimen: „Die ­Leber ist vom Hecht und nicht von einem Rochen: / Das Glück gibt manchem Fleisch, dem andern leere Knochen. / Doch werden beyde satt: und was noch ärger ist, / Ist, der es nicht ver­dient, daß der das beste frisst.“ So muß noch heute jeder, der – meist am Schanktisch – einen Leberreim wagt, zuerst feststellen, daß es sich um eine Hecht­leber handelt, dann ihre etwa vermutete sonstige Herkunft verneinen und auf die letztere einen Reim finden; ein Sinnzusammenhang ist nicht ausdrücklich verboten, aber auch nicht nötig. Allerdings bleiben die Leberreime meist (nicht wie die ansonsten vergleichbaren Lied­strophen über die Wirtin von der Lahn) züchtig: Und zu all diesen Regeln, auch wenn im World Wide Web eine Form des Nibelungenverses sich der Leber weitgehend bemächtigt hat, sollte man tunlichst (sei es nur zum Andenken Queneaus) das Versmaß des Alexandriners strikt einhalten.

Organische Metamorphose

Innerhalb dieses Korsetts herrscht aber voll­kommene Freiheit. Am nächsten liegt es zwar, die Zuordnung der Leber zu einem anderen Tier auszuschließen: „Die Leber ist vom Hecht und nicht vom Dintenfisch: / Ein Wassereimer wirkt besonders schöpferisch.“ (Karl Schimper, Gedichte, 1840) Jedoch, warum nicht auch Produkte der modernen vegetarischen Küche? Die Leber ist vom Hecht und nicht von Sojabohnen; / denn hast du Mist gebaut, dann mußt du auch drin wohnen. Oder ein politisches Statement, bei gleichzeitiger Absage an den Kannibalismus? Die ­Leber ist vom Hecht und nicht von Helmut Kohl; / und ist im Kopf ­nichts drin, dann ist er eben hohl. Und warum soll „von“ nicht ein Adelsprädikat sein? Die Leber ist vom Hecht und nicht von Thurn und ­Taxis; / was im Prinzip nicht geht, geht auch nicht in der Praxis. Das funktioniert sicher auch mit Anhalt-Zerbst/Herbst, Schaumburg-Lippe/Grippe, Hohenzollern/Kollern ... Dann gibt es auch organische Substanzen, die gewiß niemand zu seiner Nahrung braucht: Die Leber ist vom Hecht und nicht von Elfenbein; / wer Elephanten schießt, ist ohnedies ein Schwein. Und schließlich kann das „von“ auch schlicht auf lokale Herkunft deuten: Die Leber ist vom Hecht, nicht sonst von irgend­wo; / zwar geht es anders auch, ich mach’ es trotzdem so.

Damit haben wir den abstrakten Bereich betreten. Metaphorisch: Die Leber ist vom Hecht und nicht von Gottes Gnaden; / denn wer den Spott schon hat, braucht nicht auch noch den Schaden. Idiomatisch: Die Leber ist vom Hecht und nicht von vornherein: / ein grüner Aal ist grün und kann nicht purpurn sein. Adverbiell: Die Leber ist vom Hecht und nicht von ungefähr; / selbst die von heute stinkt, als ob’s schon morgen wär. Schließlich metaphysisch jenseits aller Vernunft, mit Ineinssetzung von Herkunft und Nichtherkunft (hallo, Buddhisten!): Die Leber ist vom Hecht und nicht vom Hecht in einem; / solch Meta-Hechtspruch ist besonders schwer zu reimen.
Wie Queneau am Ende seines achten Grundsonetts anmerkt, le métromane à force incarne le devin: Der Versmaß-Freak kann nicht anders, als die Rolle des Sehers zu verkörpern, und ­sieht daher auch, daß er spätestens hier aufhören muß. ... Barde, que tu me plais! toujours tu soliloques; / grignoter des bretzels distrait bien de colloques, / quand la cloche se tait et son terlintintin. („Barde, dein Selbstgespräch bringt mich stets von den Socken; / vom Brezelknabbern wird manches Gespräch recht trocken, / derweil die Turmuhr schweigt mit ihrem Klingeling.“)

weiter...

Baggterien

Scheinbar mit links wird täglich Neues erschaffen, Vorhandenes vervielfältigt. In ein paar Zeilen bekommen Sie einen tiefen Einblick ins Tagesgeschäft der Natur.

Wenn Sie ein Haus bauen wollen, brauchen Sie einen Plan. Einen Bauplan. In diesem steht dann, wie tief das Loch für den Keller sein muss, wie viele Ziegel wo gestapelt werden müssen, wo ein Fenster hinkommt und so weiter. Alles, was getan werden muss, um ein Haus entstehen zu lassen, ist auf diesem Plan verzeichnet. Aller­dings steht nirgendwo, wer das alles machen soll. Wer die ganzen Ziegel schleppen soll. Wer die Türen und Fenster einbaut und wer die Zimmer ausmalt. Das ist irgendwie nicht verwunderlich, denn der Plan wurde ja von einem Menschen geschrieben. Ich sage das jetzt sehr ungern aber wir – das schließt mich mit ein – sind nicht perfekt. Man(n) gesteht sich das selten ein, aber die Natur (ein Weibsstück) kann das besser:
Die Natur baut selten ein Haus, darum möchte ich Ihr Können am Bauplan eines Baggteriums veranschaulichen. Der Plan heißt Genom und ist in einem ziemlichen Kauderwelsch geschrieben. Unser Hausplan ist von technischer Vollendung, auf einen Blick weiß man, was das einmal werden soll. Das Genom ist nicht schön anzusehen, als Mensch sieht man es eigentlich überhaupt nicht. Es ist eine Kette komplizierter chemischer Verbindungen (Nucleotide bzw. Basen) mit Seitenketten, Ringen und allerhand chemischen Schnickschnaks, was man vereinfacht auch als Buchstabenreihe darstellen kann. Ich mache einmal einen Anfang und lese so ins Genom eines Baggteriums hinein:
ATGTTGCGGGCATTCGTAATGCTCATATAGCAACGTCAATTTCACAGCAATTC GCAAGAGAGCCAACACAAATCGTATTGGGGCCCCTTCCGTCGATCAGGCTCAA CATATGGCCCCTTGCCGTCGATCAGGCTCAACATA... usw
A, T, G, C. Nur diese vier Buchstaben. Das wirkt jetzt etwas unhandlich, eine Zeichnung wäre ­vielen wohl lieber gewesen. Es ist jedoch klar, dass das ein Code sein muss, denn es finden sich keine Höhen oder Breitenangaben irgend­welcher Art. Nichts lässt auf eine Anleitung zum Bau eines Baggteriums schließen.
Zum Glück ist der Code nicht schwer zu entschlüsseln. Immer drei Buchstaben ergeben einen Ziegel. ATG heißt START. Mathematisch ergibt das bei vier Elementen blablabla viele Kombinationsmöglichkeiten, das würde jetzt blablabla viele Ziegel ergeben. Aber hey, das Leben ist gar nicht so kompliziert, es gibt nur 20 verschiedene Ziegel (Aminosäuren). Für ein und denselben Ziegel gibt es folglich mehr als einen Code, ­anders gesagt: Ein Ziegel kann unterschiedlich codiert sein. Jetzt wissen wir also, welche Ziegel wir für den Bau unseres Baggterium, benötigen, doch wie groß soll es werden? Welche Form soll es haben? Wo sind die Höhenangaben? Wie dick wird es? Was wird es können?
Viele Fragen. Die Natur löst sie mit vollendeter Eleganz. Wir lehnen uns zurück und dürfen heute einmal zuschauen. Die Ziegel bilden wieder Ketten, genau in der Reihenfolge, wie sie auf der DNA codiert sind. Es entstehen unterschiedlich lange Ketten, die sich verschieden winden und falten. In diesem Moment offenbart die Natur ihre Genialität. Ein Teil dieser Ketten (auch Proteine genannt) sind nämlich ziemliche Wiffzacks (man nennt sie hin und wieder auch Enzyme). Diese Kerlchen leisten ganze Arbeit. Sie bauen nicht nur das Baggterium auf, sondern regeln dann im Fertigbau auch noch alle Abläufe. Das ist so, als würden die Maurer und Installateure eines Restaurants nach der Fertigstellung noch als Koch und Kellner arbeiten. Da wird Zucker in Energie verbrannt, Sauerstoff veratmet und Sonne getankt. Die Enzyme sind die Hackler am Bau, während der Rest der Proteine verarbeitet wird. Proteine können als Türen verwendet werden oder als Baugerüst. Verbaut werden aber nicht nur Proteine, sondern zum Beispiel auch Lipide (Fette) oder Polysaccharide (Zucker­verbindungen). Die Größe des Baggteriums wird schließlich durch die Anzahl der codierten Proteine bestimmt und von den physikalischen Beschränkungen der Bauweise. In dem Punkt sind wir also doch der Natur überlegen, denn einen Wolkenkratzer bekommt man eben nur mit Stahlbeton zustande.

weiter...

Verprügelt, mißbraucht, einbalsamiert

Die Absicht dieses Artikels ist es, das „Denk-Mal Marpe Lanefesch“ im Hof 6 des AAKH einer Funktionsanalyse zu unterziehen: Mit welcher Absicht wurde aus einem aufgelassenen Trafo ein Gebäude, das - in der einfachsten Interpretation seines Namens – Denkmal und Aufforderung zum „denk mal!“ in einem ist, gemacht? Und erfüllt es diesen Zweck? Und sind wir mit diesem Zweck einverstanden?

bethausDer Betpavillon im Hof 6 des AAKH ist in der letzten gezeit (5, S. 18f.) von Minna Antova sehr gut beschrieben und erklärt worden. Es ist eine gute Idee, dort alles nachzulesen, was in diesem Artikel an Hintergrund fehlt.
Ursprünglich hing nur ein Schild an dem Bau, das informierte, daß in der Reichskristallnacht die Synagoge „geschändet“ worden war (Wortlaut laut (1)). 1953 wurde sie dann in ein Trafohäuschen umgewidmet, was in architektonischer Hinsicht die Folgen der Schändung in der Reichs­kristallnacht nur noch verdeutlichte, da der Bau ungefähr in den 70ern (2) oder Anfang der 50er (5, S. 18) ziemlich gründlich umgebaut wurde: „Dabei werden die Dachkonstruktion, der Eingangs- sowie der Torahschreinvorbau zerstört.“(1)
Es läßt sich also sagen, daß das Bethaus geprügelt, mißbraucht und dann einbalsamiert wurde. Wir könnten auch sagen, es wurde verprügelt, dann verloren, vergessen oder weggeworfen, anschließend hat sich wer wiederer­innert und es in neuen, aber deutlich anderen Würden eingesetzt.

Ansichtssache 1: der Zweck des „Denk-Mal Marpe Lanefesch“

bethausIn Anbetracht der Ignoranz des Verfassers dieses Artikels betreffs der meisten nicht begrifflich vermittelten Sachverhalte ist es wohl am einfachsten und naheliegendsten, die Bedeutung der Sache zunächst aus der Bedeutung ihres Namens abzuleiten zu versuchen: also aus „Denk-Mal“ und aus „Marpe Lanefesch“ und aus deren gemeinsamen Auftreten.
„Denk-Mal“ läßt sich ohne viel Nachdenken in drei Weisen lesen: als das herkömmliche Denkmal: ein Mal, das zum Denken oder Gedenken anregen soll, aber falsch geschrieben. Die ­nächste Idee, die sich aufdrängt, ist die Aufforderung „denk mal!“, was dem Verfasser ja wahrscheinlich die ganzen Schwierigkeiten hier beschert hat. Ebenfalls ziemlich unvermittelt ist das Verständnis von „Denk-Mal“ als ein Mal, das vom Denken kommt: ähnlich wie ein Muttermal oder ein Wundmal, also eine Narbe. Diese Verständnismöglichkeiten sind eigentlich so offensichtlich, daß sie fast sicher richtig sind.
„Marpe Lanefesch“ ist hebräisch (ich kann kein hebräisch) und heißt Heilung der Seele. Es ist unklar, wessen Seele geheilt wird, und es sagt nicht, wie die Heilung eigentlich aussieht, und es sagt vor allem nicht, was der Seele eigentlich fehlt. Aber vermutlich ist eine gut abgeheilte Seele in jedem Falle wünschenswert, selbst wenn sie ursprünglich nicht verletzt oder krank war. Es ist also von einer unbestimmt beschädigten Seele auszugehen, der Heilung zuteil wird. Heilung selbst kann hier durch sich selbst (eine Wunde heilt) oder mittels äußerem Agens (die Ärztin heilt) vonstatten gehen, das läßt sich aus dem Kontext aber nicht ohne weiteres sagen. Auch die passive Wendung ist gebräuchlich (etwas wird geheilt). Weiters ist oft noch ein Mittel oder Agens in anderem Sinne in der Heilung involviert, z.B. eine Medizin oder eine Massage.
Als vorgreifende Interpretation auf die Agen­ten läßt sich sagen, daß es wohl Personen sein müßten. Diesbezüglich ist die mittlere Glas­platte im Boden zu bemerken, die mit dem Inhalt des folgenden Dokuments bedruckt ist: „Schreiben der Wiener Staatspolizei vom 10.11.1938, enthält alle Synagogen Wiens, durchgestrichen, mit den Namen der dafür Verantwortlichen [...].“ (5, S. 18)
Aus dem Zusammenhang ist ziemlich klar, daß die Verantwortlichen Verantwortliche für die Zerstörung der Synagogen sind. (Wenn diese Annahme aber falsch ist, und ich kann sie auf­grund meiner sehr mangelhaften Recherchetätigkeit nicht besser untermauern, dann sind alle auf ihr beruhenden Schlußfolgerungen zwar hoffentlich trotzdem folgerichtig, aber leider nicht sachlich.) Da für diese Gruppe von Verantwortlichen nur schwer seelenheilende Wirkung konstatiert werden können wird, werden sie nicht als direkte Agenten der Heilung zu nennen sein. Generell also läßt sich nicht gleich sagen, ob überhaupt wer, und – wenn ja – wer heilt, oder wovon die Seele geheilt wird.

Wie ist nun der Bezug der beiden Begriffe „Denk-Mal“ und „Marpe Lanefesch“ aufeinander festzulegen? Neben der eher verwegenen Theorie einer rein zufälligen Aneinanderreihung der ­beiden, ist ein Kausalverhältnis oder zumindest ein örtlicher Zusammenhang zwischen ersterem und letzterem zu vermuten: ein Denkmal, wodurch – oder eben zumindest wo – Heilung der Seele stattfindet. Eine andere Variante ist es, das Wort Denkmal in seiner üblichsten Verweisstruktur zu sehen, und die beiden als „Denkmal für die Heilung der Seele“ zu verstehen.

„Denk-Mal für“ oder „Denk-Mal wo“ oder „Denk-Mal wodurch“

bethausWelche Bedeutungen der beiden sind für diese Varianten am besten geeignet? Ein Denkmal im eigentlichen Sinn des Wortes und wie es in Denkmalschutz verwendet wird, ist sicherlich eine gute Grundlage für den örtlichen Bezug zwischen den beiden: Ein Denkmal ist ein Gegenstand und hat so seinen Ort, und wo ein Ort ist, kann formal etwas geschehen, in diesem Fall Heilung. Aber es wird sich der Ort, und vor allem dieser Ort hier, nicht oder nur schlecht von seiner Geschichte lösen lassen, vor allem wenn versucht wird zu begründen, warum ein Denkmal ein besonderer Ort sein kann oder sollte, und dieser Ort eben ein denkmalwürdiger ist, im Unterschied zum Baum daneben. Also wird über die rein örtliche Be­ziehung der beiden auch noch ein kausales Verhältnis anzunehmen sein: Weil dieses Denk-Mal dieses Denk-Mal ist, kommt es zur Heilung der Seele. Der Ort selbst, als nicht besonderer, scheint mir (in diesem Fall) immun gegen seine Geschichte.
Was diesen Ort von einem sonnenflüchtigen Mondkrater unterscheidet, ist, daß es am ersten Ort Leute gibt, die dort sind und sich was über diesen Ort denken: So wird aus einem Ort ein besonderer Ort. Und wenn sie sich denken, was dort passiert ist, z.B. weil sie etwas lesen, das wer auf ein Schild dort hingeschrieben hat, sich also irgendwie erinnern, dann ist der Ort nicht mehr immun gegen seine Geschichte. Und wenn sie dann auch noch über das bloße Erinnern hin­aus dazu kommen, sich etwas beim Erinnern zu denken, dann könnte von Gedenken die Rede sein.
Damit wäre also der „Denk-Mal“ Begriff ganz gut vereinbar: Das „Denk-Mal“ ist ein Denkmal als Ort, es ist eine Aufforderung zum Denken, da ein Schild dranhängt. Und nicht nur ein Schild – das Gebäude, in seiner neuen Form, hat eini­ge Facetten mehr als eine bloße Gedenktafel: Reichlicher Einsatz von Glas soll eine Befindlichkeit erzeugen, die auf Verwundbarkeit hinweist, berichtet (4): ­„’Durch die Transparenz des Ergänzungsmaterial [sic] ergibt sich ein Innenraum mit besonderer Körperwahrnehmung: ein Raum, der keinen Schutz bietet, der sich auf die Dauer ungemütlich auf die Körperwahrnehmung auswirkt‘, schildert Antova und hofft auf die sensibilisierende Wahrnehmung dieses Effekts.“
Wo kommt dann das Moment der Heilung hinzu? Dieser Ort, der bedrückt, anstachelt und erzählt, und dadurch seine verschiedenen Funktionen als Denk-Mal erfüllen soll, soll auch irgendwie eine Heilung der Seele in seinem Namen recht­fertigen können. Es wird wohl nichts überbleiben, als nach dem Grund für die Notwendigkeit einer Heilung der Seele zu fragen, denn wo sollte sich sonst dieser Widerspruch auflösen, daß ein so häßlicher Ort eine Genesung bewirkt? Welche eigen­artige Verletzung verlangt so eine eigen­tümliche Heilung?

Ansichtssache 2: Wie das Denk-Mal funktioniert

bethausHeilung soll also durch die Anleitung zur Er­innerung, also eine Erzählung, geleistet werden. Die Elemente, die die Erzählung „etwas heilt von etwas durch etwas“ tragen, sind zusammengefaßt folgende: Eine Seele erfährt Heilung (da sie nicht näher bezeichnet wird, bringt es am wenigsten in Verlegenheit, die Seele als Verletzte zu sehen, wenn auch nicht klar wird, was die Verletzung ist). Die Liste der Namen der Verantwortlichen muß mit dem Bau kontrastiert werden, und zwar am besten als ein Hinweis auf die Art der Ver­letzung. Denn das ist ja das Wesentliche, was noch zur Konstruktion der Geschichte fehlt: eine Handlung, die die Notwendigkeit dieses Denk-Mals begründet, nämlich warum das Denkmal eine Narbe ist und wie die Verletzung aussah. Und geheilt wird, indem der Aufforderung des Denk-Mals nachgekommen wird. Das Gebäude mit dieser glasklar dargestellten Geschichte ist so also ein Seelenheilmittel.
Die Therapie mittels dieses Gebäudes scheint nur noch in einer Hinsicht unterbe­stimmt oder zu allgemein gehalten zu sein: Was genau die Verletzung unserer kon­kreten Seelen ist. Ohne diese Bestimmung ist das Denk-Mal eine Intention, die leicht ins Leere läuft, indem nicht ge­sagt wird, ob wir, die vorbeigehenden Seelen, heilungsbedürf­tig sind, und was die Verletz­ung unserer Seelen sein könnte. Der große Fortschritt, in einem Denkmal die Liste der Verantwortlichen zu integrieren, ist eine durch­aus willkommene und kon­krete Anklage, verweist aber nicht direkt auf dasjenige, das die Narbe in den Seelen der Vorbeigehenden sein könnte.

Verweise:
1) http://de.wikipedia.org/wiki/Synagoge_im_alten_AKH_Wien
2) http://tinyurl.com/vz366 (www.dieuniversitaet-online.at)
3) http://minnaantova.com/raeume/raeume1_5.html
4) http://tinyurl.com/ylqcue (www.dieuniversitaet-online.at)
5) ÖH Uni Wien und andere: gezeit:geräumt. Zeitung der FV Gewi 06/2006

weiter...

Die Revolution

Wohin gehen wir? Wer kommt mit? Der Blick auf die neue Generation lässt Stimmen laut werden, die von verantwortungs- und orientierungslosen Jugendlichen berichten. Statt Kindern machen sie Partys. Politisch desinteressiert taumeln sie kinderlos zwischen Disco und Arbeitsplatz einher und verschwenden keinen Gedanken daran, Familien zu gründen. Darf man den „Stimmen der öffentlichen Meinung“ Glauben schenken?
Ein Bericht über Wege, Möglichkeiten und Krisen der letzten Handvoll Generationen.

Als Vikor Frankl 1977 über „Das Leiden am sinnlosen Leben“ schrieb, umriss er damit nicht nur den Weg einer Gesellschaft. Er schuf ­damit einen Begriff, welcher einer ganzen Generation persönlich einleuchtend schien. Den Begriff der „Existentiellen Frustration“.
Frankl rückt in seinen Thesen die Anfälligkeit der Gesellschaft auf ein „Gefühl der Sinnlosigkeit und inneren Leere“ ins Licht.

Wer waren also die Menschen, denen Frankl den Verlust des „Lebenssinns“ diagnostizierte?
Zweifellos war er als Dozent der Psychologie in Wien und Kalifornien eher mit der jüngeren Generation der Siebziger im Gespräch.
Anders als ihre Eltern, welche (zumindest in Wien) das klar erkenntliche Ziel Wiederaufbau und Berufsausübung zum Familienerhalt vor Augen hatten, standen sie vor einer Pers­pektivenvielfalt, die es selten zuvor gegeben hatte. Papst Paul VI. nannte Österreich im Jahre 71 bei seinem Besuch gar die „Insel der ­Seligen“. Sie fanden sich mit 8mm-Kamera im Urlaub wieder. Der Wiederaufbau war geschafft. Die Baustellen ihrer Eltern hatten sie nie betreten, den Staatsvertrag nicht unterzeichnet. Neutrali­tät und Sozialstaat schufen ein Milieu, das der neuen Generation Stabilität und Sicherheit in die Wiege legte. Und doch schien sich die Sinnsuche bedeutend schwieriger zu gestallten.

Auch auf sozialer Ebene hatte sich einiges geändert. Traditionen wichen einer individu­ellen Lebensgestaltung. Das Familienbild des Vaters, der die Familie finanziell absicherte, und der Mutter, die den Haushalt führte, war nicht mehr aktuell. Hochschulen und Studien waren für Menschen aus den unterschiedlichsten Schichten erreichbar.
Doch die Möglichkeit, sich aus mannigfaltigen Aufgaben eine zu wählen, scheint viele vor ein Problem zu stellen. Viel größer scheint die Aufgabe, seine Aufgabe zu finden, als sie bloß zu erfüllen. Frankl zitiert Harvey Bailey: „Es gibt nur eine einzige Art und Weise, das Leben auszuhalten: immer eine Aufgabe zu erfüllen haben.“

Das Leben in der alten Tradition ist neben dem Faktor „veraltet“ auch noch durch Tatsachen wie Lohngestaltung, welche den Alleiner­halt einer Familie unmachbar erscheinen lässt, geprägt. Das Wirtschaftswachstum der Nachkriegszeit macht mittlerweile kleinere Schritte. Arbeits­losigkeit kommt langsam aber sicher auf’s Tapet. Frankl kennt den Begriff der „existentiellen Leere“ auch in der Arbeitslosigkeitsneurose. Es gibt nicht nur eine Freizeit von etwas, sagt er, sondern auch eine Freizeit zu etwas. Schon Schopenhauer hatte gemeint, die Menschheit pendle zwischen Not und Langeweile.

Doch wie sieht das Leben der „neuen Generation“, der Generation der Jahrtausendwende aus?
Das Vorurteil „Jugend interessiere sich nicht für Politik“ sollte so mancher angesichts der Wahlbeteiligung von Jugendlichen zwischen 16 und 18 neu überdenken. Satte 85 Prozent der Jugend­lichen hatten den Weg zur Wahlurne gefunden.
Sowohl Vorstellungen als auch Erwartungen an die Zukunft im Berufsleben weisen bei jungen Männern und Frauen verblüffende Ähnlichkeiten auf. Einzig in der Frage nach der Vereinbarkeit von Familie und Beruf trifft man hier auf ein Gender-Gap. Betrachtet man die Frage nach der Baby-Pause, ist diese bei den weiblichen Vertretern der neuen Generation wesentlich ausgeprägter. Dem steht eine Be­vorzugung von jungen Frauen am Arbeitsmarkt gegenüber, die weder Kinder im Kleinkindalter haben noch in nächster Zeit welche wollen.
Sieht die neue Marktwirtschaft den Menschen als soziales Wesen überhaupt noch vor?

Schlagworte wie Globalisierung, Working-Poor und die New Economy sind längst kein Zukunftsgeschwätz mehr. Der Begriff des Sozialromanti­kers reift langsam aber stetig zur Metapher des leichtgläubigen Optimisten. Pensionen scheinen immer mehr Ähnlichkeiten mit Wahlversprechen aufzuweisen. Die Zahl der Eheschließungen – auf 1000 Einwohner – fiel von 8,5 (1961) auf 5,1 (1997), begleitet von drastisch rückläufigen Geburtenraten. Der längere Verbleib der Jugendlichen im Bildungssystem über die Pflichtschule hinaus ist rapide gestiegen, er zählt fast schon zur Norm. Verständlich, dass sich hier auch der Kinderwunsch oft Zeit lässt. Familien der Jugendlichen finanzieren teils unter großen Anstrengungen die Ausbildung. Und doch wartet die Angst vor Arbeitslosigkeit schon am Gipfel der Lehr- oder Studienzeit. In Anspielung auf ihre praktische und kostenlose verwendbarkeit in der freien Marktwirtschaft bekommt die neue Generation den liebevollen Kosenamen „Generation Praktikum“. Wer da noch an die Haltbarkeit eines Sozialstaates glauben möchte, braucht tatsächlich einen gewissen Hang zur Romantik.

Die Reaktionen auf die vorherrschenden Möglich­keiten der jungen Generation sind vielfältig.
Man kennt hier die „Orientierungslosen“, die in Bezug auf Lebensplanung und Zukunft keine konkreten Ziele verfolgen. Man sagt ihnen Mangel an Selbstmanagementfähigkeit und Unter­qualifizierung nach. Ihre Perspektive: Mo­dernisierungsverlierer. Ihnen schließen sich die „Nicht-jetzt-AkteurInnen“ an. Man erkenne sie an wenig Reflexionsniveau und Reflexionsbe­reitschaft, Fatalismus, Informationsdefizit und Naivität. Sie zögerten Berufsentscheidungen hin­aus. Passives Abwarten präge ihre Handlungsweise. Im Wesentlichen erkenne man sie aber an ihrem sozialromantisch verklärten Blick auf ihre berufliche Zukunft.
Erfreulicher ist denn schon der Blick auf die „Eigeninitiativen“. Sie setzen auf Eigenverantwortung und positives Denken. Leitsprüche wie „Man muss nur wollen“ und „Wer suchet, der findet“ begleiten ihr effizientes Selbstmanagement. An ihrer Seite die „Traditionell Soliden“, die sich an ihrer Eltern und Großelterngeneration orien­tieren. Sie schmieden sich einen Lebens­plan, der langfristige Sicherheit, Planbarkeit und Stabili­tät sichern soll. Dafür seien sie wesentlich unflexibler und bedürftiger, was Kontinuität be­trifft.

War es damals besser? Wird es morgen gut sein? Wohl kaum. Vielmehr gilt es aktuelle Fragen aufzuwerfen und Antworten zu finden. Auf in den Kampf!
Denn: „Der Mensch lebt nicht von der Arbeits­losenunterstützung allein.“

weiter...

Wasser für's Land und Luft für's Volk?

Endlich, der Bagger ist da! Die Zeitung, an der seit Monaten in meinem Nebenzimmer gebastelt wird! Und wenn das Ganze in meiner unmittelbaren Nähe passiert, kann ich dem doch nicht mein Wort entziehen. Im Speziellen handelt es sich hier um das Vorhaben einer riesigen Baustelle eines Staudammes, die vielen Menschen in zahlreicher Hinsicht Sorgen bereitet. Auf den ersten Blick scheint es eine komplizierte Angelegenheit zu sein, deren Beurteilung viel technisches Wissen erfordert, aber – wie so oft – bedarf es dazu eigentlich nur einer gewissen Portion an Herz und Hirn.

“Big Dams are to a nation’s “development” what nuclear bombs are to its military arsenal. They’re both weapons of mass destruction. [...] Both twentieth-century emblems that mark a point in time when human intelligence has outstripped its own instinct for survival. They’re both malignant indications of a civilization turning upon itself.”
– Arundhati Roy, Cost of Living

Das Riesenbauprojekt des Ilisu-Staudamms in Südostanatolien sorgt seit einiger Zeit für Aufsehen, vor allem aber auch für Diskussionen und Proteste auf internationaler Ebene. Auch in Österreich ist das Thema hochaktuell, da neben Schweizer Unternehmen auch die österreichischen Konzerne VA Tech Hydro und Andritz an dem Milliardenprojekt beteiligt sind.
Ich selbst hatte keinen wirklichen Bezug zu ­dieser vielschichtigen Staudammproblematik, bis ich mich Ende September 2006 auf einer Demo vor dem Finanzministerium gegen das Vorhaben wiederfand (Samba trommelnd!) und dadurch von den Hintergründen des Projektes und von Österreichs Rolle dabei erfuhr. Das Finanz­ministerium wird nämlich darüber ent­scheiden, ob die Österreichische Kontrollbank als Exportkreditversicherungsanstalt eine Exporthaftung für das Bauvorhaben übernehmen soll. Was die Demo gefordert hat, war ein ausdrückliches „Nein“.

In den türkischen Medien ist das Thema schon seit Jahren präsent, vor allem durch die zivilge­sellschaftlichen Initiativen, die lautstark ­dagegen protestieren. All diese Initiativen betonen besonders die Tatsache, dass durch den Bau die mehr als zehntausend Jahre alte archäo­logische Stätte Hasankeyf am Tigris im Stauwasser versinken wird. Diese Tatsache sollte aus einer kulturpolitischen und historischen Perspektive Grund genug sein, das Vorhaben auf der Stelle zu stoppen. Noch komplizierter wird es jedoch, wenn man an erfahrungsgemäß wahrscheinliche soziale, humanitäre, politische, völker­rechtliche, ökologische und ökonomische Folgen der Verwirklichung eines solch riesigen Staudamm­projektes denkt. Die Angelegenheit hat eben viele Facetten und die meisten von diesen werden vielleicht nicht so prompt eintreten oder bildlich nicht so leicht vorzustellen sein wie eine Unterwasserstadt.

Was liegt dem Projekt des Ilisu-Staudamms zugrunde? Was sind die Vorteile, die erwartet werden?
Dieser Staudamm ist ein wichtiger Bestandteil des so genannten Südostanatolienprojektes (Güneydogu Anadolu Projesi – GAP), welches als das Entwicklungsprojekt der Türkei seit mehreren Jahrzehnten am Laufen ist. Es wird viel Energie erzeugt (3833 GWh laut dem Staat­lichen Wasserwerk DSI), die der Region Wohlstand bringen soll. So haben wir es brav gelernt: Staudämme sind Zeichen der Modernität, des Wohlstandes und Fortschritts. Während der Bauarbeiten wird die Bevölkerung der Region Beschäftigung ­fin­den, zumindest für sieben Jahre, und die ganze Gegend wird wirtschaftlich belebt. Das Projekt wird von staatlicher Seite als die einzige Rettung der betroffenen Menschen und als der einzige Weg zu Prosperität der Region angepriesen.

Welche konkreten Probleme impliziert so ein Vorhaben? Mehrere Zehntausend Menschen werden zwangsumgesiedelt in eine Ortschaft, die an einer höheren Stelle im Tigristal gebaut wird. Das allein ist ein Prozess, der sehr langwierig und mühsam ist – und welcher am Ende immer Opfer erzeugt, die ihr Recht aus verschiedenen Gründen nicht geltend machen können oder die nicht zur Gänze ausbezahlt werden. Mehrere Tausend Menschen verlieren ihre traditionelle Beschäftigungsbasis und niemand kann vorhersagen, was nach dem Bauprojekt passiert, wenn diese Menschen nicht mehr auf der Baustelle beschäftigt werden können. Die Auswanderung in Großstädte, die spätestens dann eintreten wird, erzeugt wiederum andere soziale Spannungsfelder, unter denen die Zuwanderungsstädte der Türkei bereits seit langer Zeit leiden.

Der Staudamm ist 45 km vor der syrischen Grenze geplant, wodurch neue und dauerhafte zwischenstaatliche Konflikte zu erwarten sind. Durch die Talsperre des Flusses würde die Türkei die alleinige Macht über die Bewirtschaftung des Wassers dieses Flusses in der Hand halten. Man könnte erwarten, dass im Rahmen eines Entwicklungsprojektes in einer politisch dermaßen angespannten Region neben den rein technischen auch andere Parameter berücksichtigt werden, aber nein.

Wenn auch nur die Wahrscheinlichkeit besteht, dass einige der angesprochenen Gefahren durch Verwirklichung dieses Staudammes eintreten könnten, sollten die Zuständigen ernsthaft über ihre Verantwortung nachdenken. In einer wirtschaftlich so unterentwickelten Region ist es leicht, so ein Vorhaben als ein Entwicklungs­projekt zu verkaufen. Doch die Investitionen würden sich nur dann rechtfertigen lassen, wenn man zumindest Hoffnung auf eine nachhaltige Entwicklung hätte, die aber in diesem Fall nicht gegeben ist. Es ist ein politisches Schachspiel zugunsten der Machterhaltung, aber sicher kein Entwicklungsplan zur Friedens- oder Wohlstandsschaffung.

Die Regierung in der Schweiz hat Mitte Dezember 2006 die Zusage für eine Exportkredit­haftung an die beteiligten Schweizer Firmen gewährt, allerdings „unter Auflagen“, heißt es. „Eine unab­hängige Expertenkommission“ werde die Maßnahmen begleiten, um es sicherzustellen, dass die Vorgaben der Weltbank gewährleistet werden. Die Schweiz sieht sich als Hüter der westlichen Standards, die die türkischen Behörden oder gar die anderen beteiligten Länder nicht einzuhalten neigen. Nach diesem Vorgehen in der Schweiz wird auch in Österreich ein ähnlicher Schritt erwartet.

Wir können mit Leichtigkeit sagen, dass das politische Bewusstsein in der Türkei von dem Nachhaltigkeitsgedanken nur beschränkt geprägt ist, da in einem Entwicklungsland oftmals ­andere Werte, die zur wirtschaftlichen Stärkung des Landes dienen, die Oberhand gewinnen. Doch wie werden es Länder wie die Schweiz oder Öster­reich verantworten können, wenn in diesem großen „Entwicklungsprojekt“ etwas schief läuft?

Für weitere Informationen:
www.ilisu-wasserkraftwerk.com
www.wwf.at
www.dsi.gov.tr
www.hasankeyfgirisimi.org
www.hasankeyfesadakat.org

weiter...

Bagger am Dach der Welt

Seit bald 50 Jahren ist Tibet nun von China, je nachdem, wessen Standpunkt eingenommen wird, besetzt oder befreit und unterläuft einen Modernisierungs- oder Zerstörungsprozess. Ein kurzer Überblick über die Argumente der verschiedenen Lager und über die ­Situation der Betroffenen.

Auf der Homepage der Central Tibet Administration, der tibetischen Exilregierung des Dalai Lama in Dharamsala, findet sich zu Beginn des Textes “Vision for a Future Free Tibet” folgende Aussage: Under Tibet’s Kings and the Dalai ­Lamas, we had a political system that was firmly rooted in our spiritual values. As a result, peace and happiness prevailed in Tibet.
Auf der anderen Seite betont die Chinesische Regierung stets, dass es sich um eine „fried­liche Befreiung“ gehandelt habe. Eine Befreiung ­Tibets, das unterdrückt war von einem feudal regierenden, barbarischen Adel und einer ausbeuterischen Klosterkultur, die das Volk unter dem Vorwand der Religion zu ihren eigenen – ziemlich weltlichen – Zwecken versklavt hat. Bei näherer Betrachtung stellt sich heraus, dass beiden Seiten zutiefst zu misstrauen ist.
Während ChinesInnen, die sich inzwischen in großer Zahl in Tibet angesiedelt haben, wohl wirklich das Gefühl bekommen, dass sie Tibet modernisieren und kultivieren, sehen Exil-­TibeterInnen – auf die im Land gebliebene einheimische Bevölkerung möchte ich weiter unten eingehen – ihre Jahrtausende alte, hohe Kultur bedroht durch eine unsensible, zerstörerische Besetzermacht.

Von China befreit?

Recht haben sie beide – jeweils auf ihre Weise. Es lässt sich nicht leugnen, dass Tibet zum Zeitpunkt des Anschlusses an China, gerade nach westlichen Kriterien, bodenlos rückständig war. Und diese Rückständigkeit versucht China mit aller Macht aufzuholen. Das auffälligste Projekt ist hier der Bau einer Eisenbahnlinie, die Lhasa mit Peking verbindet. Die Sinnhaftigkeit dieses Unternehmens wurde sowohl in wirtschaftlicher als auch in ökologischer Hinsicht angezweifelt. Jiang Zemin, das damalige Staatsoberhaupt der VR China, erklärte aber in einem Interview mit der New York Times am 10. August 2001, dass dieses Projekt nicht in erster Linie wirtschaft­licher Natur sei: “Some people advised me not to go ahead with this project because it is not commercially viable. I said this is a political decision, we will make this project succeed at all costs, even if there is a commercial loss”. Im Juli 2006 wurde die Strecke fertiggestellt – zwei Jahre vor dem ursprünglich angestrebten Datum!
Im Schatten dieses Prestigeprojekts wird zur Zeit ein ganzes Netz von Highways über Tibet ge­spannt, augenscheinlich die Vorbereitung für eine umfassende wirtschaftliche und touristische Erschließung eines Landes, das sowohl reich an Bodenschätzen als auch an natürlichen und kulturellen Attraktionen für Besucher ist. Von diesen Projekten, so die chinesische Argumentation, die allerdings auch in jedem westlichen Staat funktionieren würde, profitiert natürlich auch die tibetische Bevölkerung. Beweise? Ein laut chinesischen Statistiken ständig steigendes Bruttoinlandsprodukt, säkulare Schulbildung, die es vor der „Befreiung“ nicht gab, ein großes Angebot an aus anderen Provinzen importierten Nahrungsmitteln, Haushaltswaren und anderen Konsumgütern in den Marktstraßen und neu errichteten Kaufhäusern in Lhasa, neue mo­derne Wohnungen für TibeterInnen, die bisher in mittelalterlichen Wohnungen leben mussten, ohne Strom und Sanitäranlagen, und viele andere Vorteile der guten, modernen chinesischen Lebensart.

Von China besetzt?

All diese „Errungenschaften“ sehen aber ­China-kritische Personen und Gruppen als die negativen Folgen der chinesischen Besetzung. Was bringt ein geringfügig höheres Brutto­inlandsprodukt, ein höheres Einkommen, wenn gleichzeitig ­Preise und Mieten massiv steigen? Was hat ­Tibet ­davon, wenn es touristisch und wirtschaftlich ausge­beutet wird?
Die Klöster werden von chinesischen TouristInnen überschwemmt, die von staatlicher Seite verordneten Eintrittsgelder aber fast vollständig an die chinesische Adminis­tration abgeführt. Gewaltige Waldflächen in Osttibet werden und wurden bereits abgeholzt, während das Aufforstungs­programm nur langsam anläuft. Häufigere Überschwemmungen in Bangladesh und Ost­china sind angeblich eine Folge davon, da durch die Abholzung die Berghänge weniger Wasser halten können und Flüsse wie der Brahma­putra, der Yangze oder der Mekong im Monsun viel stärker anschwellen als früher. Die reichen Rohstoffvorkommen, die von chinesischen Forschungsteams entdeckt wurden, werden abgebaut und zur Weiterverarbeitung auf den neu errichteten Straßen und Eisenbahnstrecken in chinesische Metropolen abtransportiert. Alte, angeblich baufällige Stadtviertel werden abge­rissen und durch neue, oft „in tibetischem Stil“ gehaltene ersetzt. Brutal werden neue chinesische Protz- und Einkaufs­straßen in alte Städte geschnitten, die Übersichtlichkeit und damit die Kontrollmöglichkeit erhöht. Neue Häuser, in denen die Mieten wesentlich höher und die Bauqualität schlechter ist, werden gebaut. Häuser, in denen wegen zu hoher Mieten nicht mehr nur TibeterInnen wohnen, sondern reichere ChinesIn­nen, die die soziale Struktur aufbrechen und so indirekt die Chinesische Administration vor Aufständen und Verschwör­ungen schützen.
Impor­tierte Konsumgüter machen das Land ab­hängig von ihrem Besetzer, weil gleichzeitig die traditionelle, gut funktionierende Bewirtschaftung durch Kahlschlag, Cashcrops und Kunstdünger zerstört wird. Hungersnöte gab es in Tibet angeblich erst unter chinesicher Besetzung.

Der Wert der Kultur

Wie aber geht es der einheimischen Be­völkerung, die nicht im Exil lebt, mit diesen Umständen?
Allzu viel lässt sich im Gespräch nicht erfahren. Dazu ist die Angst vor Spionage und Ver­leumdung zu groß. Da oft auch Tibeter Partei­mitglieder sind, kann eigentlich in jeder Umgebung ein all­zu kritisches Wort gefährlich sein. Allein das ist eigentlich schon kein gutes Zeichen für das Wohlbefinden der Einheimischen. Andererseits läuft in tibetischen Häusern chinesisches Fernsehen, wird (wie seit Jahrhunderten) ­chinesischer Tee getrunken, sprechen tibetische Kinder Chinesisch miteinander, obwohl sie in der Schule auch Tibetisch lernen.
Natürlich ist deshalb einer der Hauptkritikpunkte, dass die chinesische Regierung die Kultur Tibets zerstört. Wem aber bedeutet diese Kultur etwas? Zweifellos westlichen China­kritikerInnen, die dazu neigen, den ­tibetischen Buddhismus zu einer jahrtausendealten Friedens­religion und das alte Tibet zu einem Paradies auf Erden, versteckt hinter den Gipfeln des ­Himalayas, hochzustilisieren. Wohl auch einer Mehrheit inner­halb der exil-tibetischen Gemeinde, von der große Teile dem Adel angehört hatten oder Mönche aus zerstörten Monasterien sind.
Ob diese exil-tibetischen Stimmen aber eine starke Mehrheit unter den Zurückgebliebenen vertreten, ist unsicher. Zweifellos sind große Teile des tibetischen Volkes nach wie vor tief religiös und verehren den Dalai Lama inbrüns­tig. Bei der Kulturrevolution jedoch, während der zwischen 1966 und 1976 in ganz China und eben auch in Tibet kulturelle Errungenschaften in unglaublichem Maß vernichtet wurden, waren durchaus auch viele junge TibeterInnen an der Zerstörung von Klöstern beteiligt. Leute, die dem alten Feudalsystem nichts abgewinnen konnten, die – wohl durchaus auch berauscht von maoistischen Ideologien – ein besseres System erhofften.

Ausblick

Ob ein solcher Systemwandel ohne den Einmarsch Chinas geschehen wäre, ist fraglich. Zwar beteuert der derzeitige Dalai Lama Absichten in diese Richtung, allerdings war er bei seiner Flucht aus Tibet nicht einmal zwanzig Jahre alt und die Macht im Staat lag damals wohl in anderen, eher konservativen Händen. Es sollte nicht vergessen werden, dass viele seiner Vorgänger bereits im jugendlichen Alter starben – oft durch Mord –, sodass die eigentlichen Regenten weiterhin ungestört ihre Macht ausüben konnten.
Nun ist der Wandel, der Anschluss an die Außen­welt, eindeutig vollzogen. Im Vergleich zu Nachbarländern wie Indien oder Nepal sind die Straßen besser, die Alphabetisierungsrate, Einkommen und das Preisniveau höher, die Kindersterblichkeit niedriger, die Schulbildung gesicherter. Gleichzeitig mit diesen Errungenschaften hat aber auch ein typisch chinesischer, übersteigerter Kapitalismus in Tibet Einzug gehalten. Alte Stadtviertel weichen modernen Hotels, Einkaufszentren und Bankgebäuden. In den neuen Prachtstraßen prangen die Werbeschilder internationaler Konzerne. Glücksspiel und Prostitution wuchern in den Städten. Auch in abgelegenen Klöstern wird jedeR Fremde als Tourist­In behandelt, bekommt eine Eintrittskarte, auf Hochglanzpapier.
Tibet wird modern, nicht ganz so, wie man sich das im Westen vorstellt, sondern nach chinesischem Geschmack.

weiter...

"libertarianisch"

Ostblockistan: vor einigen Jahren noch arme Diktaturen. Menschen flüchteten und wurden an der Grenze erschossen – jetzt amüsieren sich TschechInnen und PolInnen in den Alpen und wir fahren ohne Visum zu ihnen, um billig zu genießen. Wieso das? Persönliche Freiheit, Kapitalismus, freier Handel usw. machten das. Nie ist ein Land ohne Handel reich geworden. Es wird noch dauern, bis die 50 Jahre Kommunazismus weg sind.

Indien lebte lange Zeit unter der Fuchtel von Nehru/Gandhi-Dynastie. Nehru: geboren, aufgewachsen und gestorben im Luxus, Indien hat er jahrelang in Armut gehalten. War ein Anhänger vom fabianischen Sozialismus und Ostblockdiktaturen haben ihm gefallen. Als Rote Armee 1956 in Ungarn massenmordete, schwieg er. Wenn jemand in Indien im Jahr 1990 einen Computer importieren wollte, brauchte er bis zu 20 Papiere. Indien liberalisierte und wurde Wirtschaftsmacht. Wer nicht weiß, was comparative advantage oder Laffer curve bedeuten, soll über die Wirtschaft schweigen.

KommunistInnen (K) haben jahrzehntelang die Entwicklung der Baustelle Welt gehindert. Die Expansion der K zu stoppen hat Unsummen gekostet. Kommunismus, form of insanity (Ronald Reagan), führt zur Verarmung aller Schichten (mit Ausnahme der K), dann zum Massenmord. Es gab noch keine K an der Macht, die nicht gemordet hätten. Auch in Westeuropa gibt es rich white kids, denen es fad ist und die an irgendeine Spielart vom Kommunismus glauben. Es gibt bessere Religionen.

Ex-DDR bekam zwischen 1990 und 2004 umgerechnet 1,5 Billionen (sic!) Dollar. Macht 7.100 Taler pro Birne und Jahr. Dazu noch die DM für die wertlose DDR-Mark. Auch deswegen geht es ihnen jetzt schlecht. Tschechien bekam von der Weltbank 626 Millionen Dollar an Krediten; zwischen 1992 und 2003 war die Gesamthilfe nur 22 Taler pro Birne und Jahr. Tschechien: kam heuer raus aus der Weltbank: reich genug.

Afrika haben wir vermasselt: zuerst Kolonialismus und dann Fantasiliarden Dollar hingeschickt; Armut steigt weiter. Afrikas Probleme sind Korruption, Diktatur, Rassismus (schon mal über Darfur und Rwanda gehört?) – und Mangel am Rechtssicherheit und Markt. Kenianischer Ökonom James Shikwati, Befürworter der Globalisierung, schreibt: „Hören Sie endlich mit der Hilfe auf … sie hat riesige Bürokratien geschaffen … unterstützt Korruption ... Menschen werden zur Abhängigkeit geführt.“ Warum hat Muhammad Yunus den Friedensnobelpreis bekommen? Ich will mehr Produkte aus armen Ländern kaufen! Aber im Supermarkt, nicht in Boutiquen!

weiter...

Mi(e)t Recht?

Tipps für Mieter und solche, die es werden wollen …

Eine Wohnung zu finden, ist die eine Sache (und gerade in Wien mittlerweile nicht mehr das Einfachste …), interessant wird es in vielen Fällen aber erst dann, wenn es um das Aushandeln des Mietvertrags geht. Aus diesem Grund hat der Bagger einen Überblick über all das zusammen­gestellt, was es vor der Vertragsunterzeichnung besonders zu beachten gilt.

Mietpreis und Lage

Das entscheidende und augenscheinlichste Kriterium bei privaten Mietwohnungen ist in den meisten Fällen der Preis, der wiederum sehr stark von der Lage der Wohnung abhängt. Zu den teuersten Lagen in Wien gehören traditionell die City sowie die Randbezirke Döbling und Hietzing. Seit einigen Jahren ebenfalls oben vertreten sind die Josefstadt und der Alsergrund, beide mit steigender Tendenz. Am günstigsten zu wohnen ist es statistisch nach wie vor in Simmering, Brigittenau und Rudolfsheim-Fünfhaus.
Neben der Lage hängt der Mietpreis noch von einer ganzen Reihe anderer Faktoren ab wie beispielsweise der Verkehrsanbindung, dem Stockwerk bzw. dem Vorhandensein eines Lifts, Balkons oder einer Terrasse. Genauere Infos, ob der Mietpreis einer Wohnung gerechtfertigt ist, bekommt man beispielsweise bei der Mieter­vereinigung.
Bei der Vereinbarung des Mietzinses selbst im Vertrag sollte sich der Mieter darüber bewusst sein, ob die Miete und die Betriebskosten je­weils separat festgeschrieben sind oder eine Pauschalmiete vereinbart ist. Eine getrennte Ausweisung der einzelnen Kosten erhöht die Transparenz, Pauschalmieten hingegen bieten den Vorteil, dass während der Vertragslaufzeit die Betriebskosten nicht erhöht werden können, da sie nicht eigens ausgewiesen sind. Eine Wertsicherungsklausel sichert den Vermieter gegen die allgemeine Preissteigerung ab und führt zu einer jährlichen Anpassung der Miete um die Steigerungsrate des Verbraucherpreisindizes (VPI).

Befristung, „Vor“Verträge und Rücktrittsrechte

Als heikler Punkt beim Abschluss eines Mietvertrags stellt sich häufig die Befristung heraus. Hierbei gilt, dass eine Vertragsdauer von min­destens 3 Jahren vereinbart werden muss, welche auch bei einer Verlängerung des Mietvertrags besteht. Bei einer geringeren vereinbarten Mietdauer ist die Befristung automatisch als nichtig zu betrachten und es liegt somit ein unbefristeter Mietvertrag vor. Der Vorteil von unbefristeten Mietverträgen sind umfangreichere Rechte insbesondere im Bereich des Kündigungsschutzes. Wird ein zuvor befristeter Vertrag nicht verlängert oder aufgelöst, gilt er automatisch als um weitere 3 Jahre verlängert. Dies ist allerdings nur für den Vermieter verbindlich, der Mieter selbst kann unter Einhaltung einer 3-monatigen Kündigungsfrist aus dem Vertrag aussteigen.

Noch bevor der eigentliche Hauptvertrag unterschrieben wird, ist es in manchen Fällen üblich, einen Vorvertrag zu unterschreiben. Unter dem Vorwand, nur die wichtigsten Punkte festhalten zu wollen sowie um die Wohnung für den potenziellen Mieter zu reservieren, drängen Makler zuweilen zum Unterschreiben eines Vorvertrags. Dieser Vorvertrag kann jedoch sehr schnell recht­liche Gültigkeit erlangen, wenn das Mietobjekt und der Mietzins ausreichend genau bestimmt sind. In diesem Fall liegt anstatt eines Vorver­trags bereits ein fertiger und gültiger Mietvertrag vor. Auch mündliche Zusagen gelten bereits als gültige Verträge, selbst wenn in diesen Fällen die Beweislage später zu Problemen zwischen Mieter und Vermieter führen kann. Befristungen können hingegen nur durchgesetzt werden, wenn eine schriftliche Fixierung erfolgt ist.

Eine gänzliche Rücktrittsmöglichkeit von Miet­verträgen gibt es in der Folge lediglich in Fällen, wo es gleich am Tag der ersten Wohnungs­be­sich­tigung zum Unterzeichnen eines (Vor)Vertrags gekommen ist. Um die Gefahr einer Über­rumpelung bei der Vertragsunterschrift zu vermindern, gibt es gemäß §30a Konsumentenschutzgesetz für diese Mieter die einwöchige Möglichkeit zum Vertragsrücktritt. Diese Frist gilt ab Erhalt von Vertragsdurchschrift und schriftlicher Belehrung über das Rücktrittsrecht, endet jedoch jedenfalls 1 Monat nach der ersten Wohnungsbesichtigung.

Kaution, Provision und Ablöse

Mit der Erstellung des Vertrags werden für den Mieter sogleich weitere Zahlungen fällig. Fast immer muss der zukünftige Mieter eine Kaution als Sicherstellung für die ordnungsgemäße Benützung der Wohnung beim Vermieter hinterlegen. Solche Kautionen bewegen sich zwischen dem 1- bis 3-Fachen der monatlichen Bruttomonatsmiete, werden allerdings bei Beendigung des Mietvertrags rückerstattet. Empfehlenswert ist es außerdem, gleich im Mietvertrag die jährliche Verzinsung der Kaution (z.B. 4% Handels­zinssatz) festzulegen, um späteren Diskussionen zu entgehen.
Ebenfalls von Vorteil kann es bei Beendigung des Mietvertrags sein, anhand von Fotos schon vor Bezug der Wohnung eventuell bestehende Mängel festzuhalten. Dies erleichtert die Argumentation bei späteren Unklarheiten über die Rückerstattung der Kaution.

Eine zusätzliche finanzielle Bürde für Neu­mieter sind häufig Maklerprovisionen. Bei der Vermitt­lung über einen Immobilien-Makler können Beträge bis zum 3-Fachen der monatlichen Bruttomiete anfallen, meist gibt es aller­dings Spielraum für Nachlässe. Grund­sätzlich steht einem jeden Makler nur dann eine Provision zu, wenn seine Tätigkeit als entscheidend für den Vertragsabschluss zu be­zeichnen ist. Ablösen für Wohnungen sind indes gänzlich verboten und können auch im Nachhinein angefechtet werden, erlaubt sind lediglich Ablösen für Mobiliar.

Kündigungsschutz & Mietzinsminderung

Ist ein Mietvertrag schließlich im Sinne beider Seiten abgeschlossen, bestehen seitens des Ver­mieters nur wenige Möglichkeiten, den Miet­vertrag vorzeitig zu kündigen. Die wichtigsten Gründe für die Kündigungsmöglichkeit durch den Vermieter sind daher die Nichtbezahlung der Miete, die Nichtbenützung der Wohnung, eine vollkommene Untervermietung (gegen unverhältnismäßig hohes Entgelt) sowie bei nachge­wiesen erheblich nachteiligem Gebrauch des Miet­objekts. Seltenere Gründe sind der dringende Eigenbedarf des Vermieters, die Verhinderung einer Verbesserung einer Sub­standardwohnung oder der behördlich genehmigte Abbruch des Wohnhauses. Zeitgleich ist aber auch der ­Mieter durch den Vertrag daran gebunden, für die gesamte Dauer die Miete zu bezahlen. Nur in Aus­nahmefällen kann der Vertrag unter Einhaltung einer 3-monatigen Kündigungsfrist aufgelöst werden, ansonsten ist man auf das Einver­nehmen mit dem Vermieter angewiesen.

Dieses Einvernehmen mit dem Vermieter ist auch bei Erhaltungsarbeiten, für die im Regelfall der Vermieter aufkommen muss, nützlich. ­Kommt der Vermieter dieser Pflicht nicht nach, kann der Mieter zuerst schriftlich auf diesen Missstand hinweisen und bei Nichtbefolgen des Vermieters ab diesem Zeitpunkt einen adäqua­ten Teil der Miete zurückhalten. Diese Mietzins­minderung gemäß §1096 ABGB sollte dabei jedoch im Verhältnis zur bestehenden Wohneinschränkung stehen.

Untermiete

Auch beim Thema Untermiete stehen dem ­Mieter eine ganze Reihe von Rechten zu, so kann der Vermieter nur bei Vorhandensein wichtiger Gründe ein Verbot zur Untermiete erlassen. Zu diesen Gründen zählen neben einer gänzlichen Untervermietung sowie dem Verlangen einer unverhältnismäßig hohen Miete vor allem auch eine drohende Überbelegung bei mehr Personen als Räumen oder wenn Grund zur Annahme be­steht, dass der Untermieter den Hausfrieden stört. Untermieter selbst besitzen im Übrigen weitestgehend dieselben Rechte wie der Hauptmieter, lediglich wenn es um die Kosten für Erhaltungsarbeiten oder um die Kontrolle von Betriebskostenabrechnungen geht, ist der Untermieter auf den Hauptmieter angewiesen.

Beratungsstellen

Sollten sich weitere Fragen und Unklarheiten bei Mietfragen ergeben, haben sich in der Vergangenheit vor allem zwei Institute bewährt. Zum einen die Mietervereinigung, bei der man jedoch Mitglied sein muss, um Beratungen in Anspruch nehmen zu können. Zum anderen die kundigen Berater des Vereins für Konsumenteninformation (VKI), wo für gut angelegte 10€ eine halbstündige Beratung angeboten wird, die sich meist sehr schnell wieder gerechnet hat …

Verein für Konsumenteninformation
Mariahilferstraße 81, 1060 Wien
Telefon: 01/588 77 - 0
www.konsument.at

Mietervereinigung
Reichsratsstraße 15, 1010 Wien
Tel.: 01/401 85
www.mietervereinigung.at

weiter...

Seiten

RSS - #1, Jan 07 abonnieren